trib2

Ensembl ID:
ENSDARG00000068179
ZFIN ID:
ZDB-GENE-091207-3
Human Orthologue:
TRIB2
Human Description:
tribbles homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:30809]
Mouse Orthologue:
Trib2
Mouse Description:
tribbles homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2145021]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16440 Essential Splice Site Available for shipment Available now
sa23798 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16440
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098424 Essential Splice Site 188 343 2 3
Genomic Location:
Chromosome 20 (position 45684504)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCTCCGAGACCTCAAGCTGAGGAAGTTCGTCTTCAAGAATGAGGACAG[G/T]TAATAMAGATGTCTGCTTGCAAACCGAACATGCATATTCTGACTAGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23798
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098424 Nonsense 327 343 3 3
Genomic Location:
Chromosome 20 (position 45698771)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCATCACTCCGGCCGTCAACCATGGAAGAAACGAACGGGAGTTGGAC[C/T]AAATGGTACCAGAGGCCAACATGGAAGAAGAACTAGAACAGTTCTTTAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dax59qsk