ing5b

Ensembl ID:
ENSDARG00000068175
ZFIN ID:
ZDB-GENE-030616-462
Description:
inhibitor of growth [Source:RefSeq peptide;Acc:NP_001007169]
Human Orthologue:
ING5
Human Description:
inhibitor of growth family, member 5 [Source:HGNC Symbol;Acc:19421]
Mouse Orthologue:
Ing5
Mouse Description:
inhibitor of growth family, member 5 Gene [Source:MGI Symbol;Acc:MGI:1922816]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25858 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098415 Essential Splice Site 93 239 4 8
Genomic Location (Zv9):
Chromosome 2 (position 36328331)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36625041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGTACTGACACACCAGTAAAGTAAAAACAAATGAATTTATATTTCCA[G/T]GTGGATAAACACATTCGGCGCTTGGATGCTGAGCTAGCACGCTTTGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link