ehmt1a

Ensembl ID:
ENSDARG00000068157
ZFIN ID:
ZDB-GENE-040724-44
Description:
histone-lysine N-methyltransferase, H3 lysine-9 specific 5 [Source:RefSeq peptide;Acc:NP_001025302]
Human Orthologue:
EHMT1
Human Description:
euchromatic histone-lysine N-methyltransferase 1 [Source:HGNC Symbol;Acc:24650]
Mouse Orthologue:
Ehmt1
Mouse Description:
euchromatic histone methyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1924933]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18521 Essential Splice Site Available for shipment Available now
sa8190 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7277 Essential Splice Site Mutation detected in F1 DNA During 2014
sa25299 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098364 None None 1059 None 23
ENSDART00000125042 None None 759 None 20
ENSDART00000125175 Essential Splice Site None 321 None 11
ENSDART00000126018 Essential Splice Site None 1058 None 24
ENSDART00000126880 None None 807 None 21
Genomic Location:
Chromosome 5 (position 31153120)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAACTTTTGAGAWATTGTACAAAAATGCAAGCCATTAKAAGTTAGCCGG[T/A]AAGTATGCRCTAAGCYGCTGWAATTGCAATATGTGAGAWATCTCTAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098364 Essential Splice Site 336 1059 6 23
ENSDART00000125042 Essential Splice Site 53 759 1 20
ENSDART00000125175 None None 321 None 11
ENSDART00000126018 Essential Splice Site 336 1058 7 24
ENSDART00000126880 Essential Splice Site 53 807 1 21
Genomic Location:
Chromosome 5 (position 31147238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACAYTGGCTGAGGGCAAGTGCATGGCTGTGGAGAGTGTTGATGGGAAG[G/A]TAAAACRTGTCTCACATTTAGYTGTCTGTGAAAGTGATTCAAAATTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098364 None None 1059 None 23
ENSDART00000125042 Essential Splice Site 152 759 5 20
ENSDART00000125175 None None 321 None 11
ENSDART00000126018 None None 1058 None 24
ENSDART00000126880 Essential Splice Site 200 807 6 21
Genomic Location:
Chromosome 5 (position 31144120)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCAAAATAGGTTATTTTAAAAAGTTGGCTTTTATGTYAMAAGATTTAT[G/A]TAAACAAAGCTCACTATGAGCGCTCTTGTWATTGACCTAAACTTTTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098364 Nonsense 965 1059 22 23
ENSDART00000125042 Nonsense 671 759 19 20
ENSDART00000125175 Nonsense 227 321 10 11
ENSDART00000126018 Nonsense 964 1058 23 24
ENSDART00000126880 Nonsense 719 807 20 21
Genomic Location:
Chromosome 5 (position 31130555)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTAGCAGGTTTATGAATCATCTTTGTGAGCCCAATCTATTCCCAGTA[C/T]GAGTGTTCACCAAACATCAAGACATGCGCTTTCCTCGTATTGCATTCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hnihd82l