tprg1l

Ensembl ID:
ENSDARG00000068149
ZFIN ID:
ZDB-GENE-070531-2
Description:
Family with sequence similarity 79, member A [Source:UniProtKB/TrEMBL;Acc:B8A4V5]
Human Orthologue:
TPRG1L
Human Description:
tumor protein p63 regulated 1-like [Source:HGNC Symbol;Acc:27007]
Mouse Orthologue:
Tprgl
Mouse Description:
transformation related protein 63 regulated like Gene [Source:MGI Symbol;Acc:MGI:1915058]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14570 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098363 Essential Splice Site 211 275 5 6
Genomic Location:
Chromosome 8 (position 51065583)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAACACCCCATGGCACACGCAGATGAAAAGGTGGCTTCCCTCTGCCAGG[T/C]AAATCTGATTCTTGCTTGTGTTGTCAAAAAWACAGTTGAAGTCAGAATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ff2jaown