arrdc1a

Ensembl ID:
ENSDARG00000068148
ZFIN ID:
ZDB-GENE-030925-15
Description:
arrestin domain containing 1a [Source:RefSeq peptide;Acc:NP_001004561]
Human Orthologue:
ARRDC1
Human Description:
arrestin domain containing 1 [Source:HGNC Symbol;Acc:28633]
Mouse Orthologue:
Arrdc1
Mouse Description:
arrestin domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2446136]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6981 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6981
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098360 Nonsense 434 445 7 8
Genomic Location:
Chromosome 5 (position 31158810)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CSTCTTCTGCGAGCGTGCCTCCCAGCTATAGGTCTTCAGCTTATCCACAA[G/T]GTGTGACACACAGTCATTGCATTTGAATANNNGTTGGTTATATAGAGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j747guxa