LOC100331628

Ensembl ID:
ENSDARG00000068141
Human Orthologue:
TNFSF11
Human Description:
tumor necrosis factor (ligand) superfamily, member 11 [Source:HGNC Symbol;Acc:11926]
Mouse Orthologue:
Tnfsf11
Mouse Description:
tumor necrosis factor (ligand) superfamily, member 11 Gene [Source:MGI Symbol;Acc:MGI:1100089]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38731 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098355 Nonsense 6 251 1 4
Genomic Location (Zv9):
Chromosome 9 (position 18539668)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 18015738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGACAGGATCTGTGCCGCGATCGGGCGTTCATGGCAGCTAATGATTA[T/A]CGCGCTTACCTGCGGAATCATATCGATATGGAAGAGGCTCCGGCGCGCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genetic determinants of trabecular and cortical volumetric bone mineral densities and bone microstructure. (View Study)
  • Cortical thickness: WNT16 influences bone mineral density, cortical bone thickness, bone strength, and osteoporotic fracture risk. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link