si:ch211-215c18.6

Ensembl ID:
ENSDARG00000068130
ZFIN IDs:
ZDB-GENE-060526-107, ZDB-GENE-060825-33
Description:
hypothetical protein LOC791588 [Source:RefSeq peptide;Acc:NP_001038895]
Human Orthologue:
C9orf9
Human Description:
chromosome 9 open reading frame 9 [Source:HGNC Symbol;Acc:1367]
Mouse Orthologue:
1700026L06Rik
Mouse Description:
RIKEN cDNA 1700026L06 gene Gene [Source:MGI Symbol;Acc:MGI:1917237]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26492 Nonsense Mutation detected in F1 DNA During 2017
sa33624 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26492
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098336 Nonsense 48 220 2 4

The following transcripts of ENSDARG00000068130 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 31309626)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29070983
KASP Assay ID:
2259-5942.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCAAGAGAACATGCAAGGGACAGAACAGAGCCTGTCTCCACCATAAAA[C/T]AGGTCATTATGATTTATTAACAGTTTTATAAAGTCATACAGTTCCCACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33624
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098336 Nonsense 71 220 3 4

The following transcripts of ENSDARG00000068130 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 31309105)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29070462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACCATTGCAGCAATTCAACTGACAGGAGCATCTTTTTACTCTTTCTG[G/T]AAATTATTTCTGATCTTGAAGGTGTTTTAAAACAACTGGAGTCCTCAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link