si:ch211-107o23.1

Ensembl ID:
ENSDARG00000068128
ZFIN ID:
ZDB-GENE-030829-40
Description:
hypothetical protein LOC571470 [Source:RefSeq peptide;Acc:NP_001038684]
Human Orthologue:
PPP1R15B
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 15B [Source:HGNC Symbol;Acc:14951]
Mouse Orthologue:
Ppp1r15b
Mouse Description:
protein phosphatase 1, regulatory (inhibitor) subunit 15b Gene [Source:MGI Symbol;Acc:MGI:2444211]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8535 Nonsense Mutation detected in F1 DNA During 2017
sa10383 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8535
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098334 Nonsense 211 436 2 3
ENSDART00000125326 Nonsense 263 488 2 3
Genomic Location (Zv9):
Chromosome 18 (position 27025187)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27098442
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAAAGCGACAAACTCTGGGAWCTTCTGACCAAGTCGACTGATCCATA[T/G]CACCCGCTGCACTTCACAGCTTGCTTGTCCACTGTAGTTACTGAAAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10383
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098334 Essential Splice Site 366 436 2 3
ENSDART00000125326 Essential Splice Site 418 488 2 3
Genomic Location (Zv9):
Chromosome 18 (position 27025653)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27098908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGACATCTGTTCAAGGCAACCAGAAGAGAAGTCCCARATTAAAGAAG[G/A]TAATGATCAGTCACAAATAAACCAGTCGCCTAAAAATGAAAGTTTGCAKT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link