si:ch211-37p17.5

Ensembl ID:
ENSDARG00000068124
ZFIN ID:
ZDB-GENE-081105-91
Description:
Novel protein similar to H.sapiens OPN5, opsin 5 (OPN5) [Source:UniProtKB/TrEMBL;Acc:B0S8K9]
Human Orthologue:
OPN5
Human Description:
opsin 5 [Source:HGNC Symbol;Acc:19992]
Mouse Orthologue:
Opn5
Mouse Description:
opsin 5 Gene [Source:MGI Symbol;Acc:MGI:2662912]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2443 Essential Splice Site F2 line generated During 2017
sa5778 Essential Splice Site F2 line generated During 2017
sa8471 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2443
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098326 Essential Splice Site 127 365 3 6
ENSDART00000141691 Essential Splice Site 98 374 2 5
ENSDART00000098326 Essential Splice Site 127 365 3 6
ENSDART00000141691 Essential Splice Site 98 374 2 5
Genomic Location (Zv9):
Chromosome 8 (position 51752886)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49503273
KASP Assay ID:
554-3049.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGCTCTGTCGTCCGTCTGCTGCCTCAAAGTCTGCTTCCCAAACTACGG[T/C]AATYTTCCTTTGACAACATTCAAGTCAAGATGRCATTTGTGAACGTACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5778
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098326 Essential Splice Site 127 365 3 6
ENSDART00000141691 Essential Splice Site 98 374 2 5
ENSDART00000098326 Essential Splice Site 127 365 3 6
ENSDART00000141691 Essential Splice Site 98 374 2 5
Genomic Location (Zv9):
Chromosome 8 (position 51752886)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49503273
KASP Assay ID:
554-3049.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGCTCTGTCGTCCGTCTGCTGCCTCAAAGTCTGCTTCCCAAACTACGG[T/C]AATYTTCCTTTGACAACATTCAAGTCAAGATGRCATTTGTRAACGTACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098326 Nonsense 282 365 6 6
ENSDART00000141691 Nonsense 253 374 5 5
Genomic Location (Zv9):
Chromosome 8 (position 51739238)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49489625
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCTGACAATGTCCCACCAATGGCCTTTGCRTTAGCAGCTATATTYGCC[A/T]AATCCTCCACCATCTACAAYCCTGTGGTCTACCTGGTATTCAAGCCCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link