gkap1

Ensembl ID:
ENSDARG00000068123
ZFIN ID:
ZDB-GENE-040426-2485
Description:
G kinase-anchoring protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6NWC9]
Human Orthologue:
GKAP1
Human Description:
G kinase anchoring protein 1 [Source:HGNC Symbol;Acc:17496]
Mouse Orthologue:
Gkap1
Mouse Description:
G kinase anchoring protein 1 Gene [Source:MGI Symbol;Acc:MGI:1891694]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34498 Essential Splice Site Mutation detected in F1 DNA During 2017
sa7621 Missense Mutation detected in F1 DNA During 2017
sa34497 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028009 Essential Splice Site None 377 1 13
ENSDART00000098319 Essential Splice Site None 368 1 12
ENSDART00000135675   None 168 None 4
ENSDART00000135714   None 207 None 6
ENSDART00000138810 Essential Splice Site None 28 1 3
Genomic Location (Zv9):
Chromosome 8 (position 51989497)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49739884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCAGTTTCCACTTGCACGAAGCCGAAGGTACCGACAAGTCCTAACCAG[G/A]TGAAAGTTTGCTTAGTAAATTATAACACCGCCGTTATTATAATCCCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028009 Missense 14 377 2 13
ENSDART00000098319 Missense 14 368 2 12
ENSDART00000135675 Missense 14 168 1 4
ENSDART00000135714 Missense 14 207 2 6
ENSDART00000138810 Missense 14 28 3 3
Genomic Location (Zv9):
Chromosome 8 (position 51985985)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49736372
KASP Assay ID:
554-4022.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGTCTAGGATGGCATCAGCAGTGATCTCCGTGCCCACCACCGCCTCA[C/T]GCTTCGCCCTGCTGCAGGTCGACTCTGATTCGGACTCAGATTCAGATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028009 Nonsense 282 377 8 13
ENSDART00000098319 Nonsense 282 368 8 12
ENSDART00000135675   None 168 None 4
ENSDART00000135714   None 207 None 6
ENSDART00000138810   None 28 None 3
Genomic Location (Zv9):
Chromosome 8 (position 51974405)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49724792
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGGAGAAGAAAGACCAGGAAATCGCAAAGTTGAAAAAGACAATTTCA[C/T]AATGGGAGGTAAGATGAAATGAGAAATGCTGCAGCAGCAGTAGTGAAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link