si:ch211-215c18.4

Ensembl ID:
ENSDARG00000068122
ZFIN ID:
ZDB-GENE-060526-106
Description:
Uncharacterized protein FLJ46082 homolog [Source:UniProtKB/Swiss-Prot;Acc:A2BFC9]
Human Orthologue:
C9orf171
Human Description:
chromosome 9 open reading frame 171 [Source:HGNC Symbol;Acc:33776]
Mouse Orthologue:
1700101E01Rik
Mouse Description:
RIKEN cDNA 1700101E01 gene Gene [Source:MGI Symbol;Acc:MGI:2685669]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40458 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098323   None 209 None 5
ENSDART00000125586 Nonsense 190 221 5 5
ENSDART00000137400 Nonsense 209 240 7 7
ENSDART00000145021 Nonsense 209 240 7 7
Genomic Location (Zv9):
Chromosome 5 (position 31391350)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29152707
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTCTATGTTTTCGTATTCTGCAGGTGGGAGCGGCTCTGGACACCTTT[C/T]GAGATCCTGAAGCCCGGAAAAAAGCCATGAACGCCCACTGCTCTGAGTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link