si:ch211-89p1.1

Ensembl ID:
ENSDARG00000068114
ZFIN ID:
ZDB-GENE-060531-67
Description:
F11 receptor [Source:RefSeq peptide;Acc:NP_001076451]
Human Orthologue:
F11R
Human Description:
F11 receptor [Source:HGNC Symbol;Acc:14685]
Mouse Orthologue:
F11r
Mouse Description:
F11 receptor Gene [Source:MGI Symbol;Acc:MGI:1321398]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26496 Essential Splice Site Mutation detected in F1 DNA During 2017
sa26497 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098315 Essential Splice Site 15 294 1 7
ENSDART00000146331 Essential Splice Site 15 222 1 6
Genomic Location (Zv9):
Chromosome 5 (position 31458981)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29220338
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAAATGTTGACTTTAGTCTTTGTGTGTCTCTCTTTTTCACTCACAGG[T/G]AAGAGTCCATTTCTTCAGTGGTTGTTTGTTTTTTTTCTTTGTGGATCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098315 Nonsense 101 294 4 7
ENSDART00000146331 Nonsense 101 222 4 6
Genomic Location (Zv9):
Chromosome 5 (position 31460102)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29221459
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGAGGACTGAGATTTCAAAAAGTAACGCGAGCAGACGCTGGAGATTA[T/G]AACTGTGAGGTTTCTGGAAACGGTGGATATGGAGAGAATACCATCAAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link