ENSDARG00000068104

Ensembl ID:
ENSDARG00000068104
Human Orthologues:
DLK1, DLK2, DLL1, DLL3, DLL4
Human Descriptions:
delta-like 1 (Drosophila) [Source:HGNC Symbol;Acc:2908]
delta-like 1 homolog (Drosophila) [Source:HGNC Symbol;Acc:2907]
delta-like 2 homolog (Drosophila) [Source:HGNC Symbol;Acc:21113]
delta-like 3 (Drosophila) [Source:HGNC Symbol;Acc:2909]
delta-like 4 (Drosophila) [Source:HGNC Symbol;Acc:2910]
Mouse Orthologues:
Dlk1, Dlk2, Dll1, Dll3, Dll4
Mouse Descriptions:
delta-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104659]
delta-like 1 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:94900]
delta-like 2 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2146838]
delta-like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1096877]
delta-like 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1859388]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23335 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23335
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098297 Essential Splice Site 362 783 6 14
Genomic Location:
Chromosome 18 (position 33639210)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAAGTGTGTGTGTGACACTAATTGGGGCGGCCTGCTCTGTGACAAAG[G/A]TGAGATGACACCTGTAACATGAAGAAATGTGCTGGTGGCTTTTTCTGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)
  • Type 1 diabetes: The imprinted DLK1-MEG3 gene region on chromosome 14q32.2 alters susceptibility to type 1 diabetes. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vzw88it7