si:ch211-240g9.1

Ensembl ID:
ENSDARG00000068100
ZFIN ID:
ZDB-GENE-050419-194
Description:
Novel protein similar to human family with sequence similarity 19 (Chemokine (C-C motif)-like), memb
Human Orthologue:
FAM19A5
Human Description:
family with sequence similarity 19 (chemokine (C-C motif)-like), member A5 [Source:HGNC Symbol;Acc:2
Mouse Orthologue:
Fam19a5
Mouse Description:
family with sequence similarity 19, member A5 Gene [Source:MGI Symbol;Acc:MGI:2146182]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21205 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21205
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098291 Nonsense 41 132 2 5
ENSDART00000133348 Nonsense 41 125 2 3
Genomic Location (Zv9):
Chromosome 8 (position 11133341)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 10582127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGTGTGTGTGTGTTTCCTCCGCAGGTCAGTTGGCAGTAGGCACATGT[G/T]AGATAGTGATGTTGAATAGAGACAGCAGTCAACCCAAGCGCACTATCGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Pancreatic cancer: Genome-wide association study identifies five loci associated with susceptibility to pancreatic cancer in Chinese populations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link