fadd

Ensembl ID:
ENSDARG00000068099
ZFIN ID:
ZDB-GENE-070606-3
Human Orthologue:
FADD
Human Description:
Fas (TNFRSF6)-associated via death domain [Source:HGNC Symbol;Acc:3573]
Mouse Orthologue:
Fadd
Mouse Description:
Fas (TNFRSF6)-associated via death domain Gene [Source:MGI Symbol;Acc:MGI:109324]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16977 Nonsense Available for shipment Available now
sa21084 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16977
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098288 Nonsense 8 196 1 3
Genomic Location:
Chromosome 7 (position 55004994)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGYGCCGTGTTAGCATTCAAACATGGACAAGAGAGGATTCCGAGCAATGT[T/A]GCTAGAAATTTCCGACAAGCTTACAGATGATAACGTGGCCAAATTAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098288 Essential Splice Site 188 196 3 3
Genomic Location:
Chromosome 7 (position 55010772)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAGGAGAGAGCTTTTTGTAATTACTGTGAATTTCCTTTATCTTAAGA[G/A]CAAAATAACTCTAAATCGTTTACAGATCTTCCTGAAGGAGTCGAGCACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y7rcwss1