si:dkey-127j5.5

Ensembl ID:
ENSDARG00000068096
ZFIN ID:
ZDB-GENE-060526-205
Description:
hypothetical protein LOC566223 [Source:RefSeq peptide;Acc:NP_001122203]
Human Orthologue:
ATF5
Human Description:
activating transcription factor 5 [Source:HGNC Symbol;Acc:790]
Mouse Orthologue:
Atf5
Mouse Description:
activating transcription factor 5 Gene [Source:MGI Symbol;Acc:MGI:2141857]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40462 Nonsense Mutation detected in F1 DNA During 2017
sa31451 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40462
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098285 Nonsense 187 511 3 4
Genomic Location (Zv9):
Chromosome 5 (position 32054730)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29815560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGTGGGGGTCCCATTGGCCGTACCAAGATTCCAAGACATGCCCCCTA[C/A]AGCTGCAGCCGCCCCAACAGCAACGTCTGCAGCCGCAAGAGAGTTTCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31451
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098285 Nonsense 470 511 4 4
Genomic Location (Zv9):
Chromosome 5 (position 32053716)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29814546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGGAAACGAGCAGAGTTGGACTCATTGGAGGAACAGCTTCATGGTCTG[G/T]AGGGCAGAAATCGTGAGCTCCGGGACAAGGCAGAATCGGTGGAACGGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link