ENSDARG00000068085

Ensembl ID:
ENSDARG00000068085

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21127 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21127
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098268 Nonsense 21 510 1 6
Genomic Location (Zv9):
Chromosome 7 (position 68082752)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 10887352
GRCz10 15 43773229
GRCz10 21 42432061
GRCz10 3 57568799
GRCz10 5 26444770
GRCz10 7 65744610
GRCz10 9 23886633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTACTAATGTGTTACCAGACCTACCAACCTCAAATCTAAATATTGTAT[T/A]GGAGACATTACAATCTTTAGGTGTGGGAGCCACTGAAGATTTACAGTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link