psmd7

Ensembl ID:
ENSDARG00000068076
ZFIN ID:
ZDB-GENE-030131-5541
Description:
26S proteasome non-ATPase regulatory subunit 7 [Source:RefSeq peptide;Acc:NP_956083]
Human Orthologue:
PSMD7
Human Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 [Source:HGNC Symbol;Acc:9565]
Mouse Orthologue:
Psmd7
Mouse Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 Gene [Source:MGI Symbol;Acc:MGI:1351511]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30356 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30356
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098229 Essential Splice Site 25 327 1 7
Genomic Location (Zv9):
Chromosome Zv9_scaffold3511 (position 34256)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67092994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGTCGTTCATCCTTTGGTGCTACTGAGTGTCGTGGACCATTTTAACAG[G/A]TAAATTTGAGTGCCGTGATGGTGCTGAAATAAAAGTGTTAACTCACTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link