tmem119b

Ensembl ID:
ENSDARG00000068036
ZFIN ID:
ZDB-GENE-070410-49
Description:
transmembrane protein 119b [Source:RefSeq peptide;Acc:NP_001082912]
Human Orthologue:
TMEM119
Human Description:
transmembrane protein 119 [Source:HGNC Symbol;Acc:27884]
Mouse Orthologue:
Tmem119
Mouse Description:
transmembrane protein 119 Gene [Source:MGI Symbol;Acc:MGI:2385228]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33634 Nonsense Mutation detected in F1 DNA During 2016
sa16859 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33634
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098160 Nonsense 77 294 2 2
Genomic Location (Zv9):
Chromosome 5 (position 33510532)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31272764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGTCCACCTCCATAGATGGAGATAAACAAACCAAACCATTCTGGAAT[C/T]AAGCAGCAGATTTTTTAAAAGAGAACCACCTCCCCATAATCGTCATTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16859
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098160 Nonsense 193 294 2 2
Genomic Location (Zv9):
Chromosome 5 (position 33510184)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31272416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCACTCAAGAGTCCGWGGAAGGAGAAGAGTGAAGAGGCAGAAGCCCAA[A/T]AACCTGCARAGGRGGAGGAAAGTCCTCTATGTGAGCTGAGTCAAGAGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link