ENSDARG00000068030

Ensembl ID:
ENSDARG00000068030
Human Orthologues:
APOL1, APOL2, APOL3, APOL5, APOL6
Human Descriptions:
apolipoprotein L, 1 [Source:HGNC Symbol;Acc:618]
apolipoprotein L, 2 [Source:HGNC Symbol;Acc:619]
apolipoprotein L, 3 [Source:HGNC Symbol;Acc:14868]
apolipoprotein L, 5 [Source:HGNC Symbol;Acc:14869]
apolipoprotein L, 6 [Source:HGNC Symbol;Acc:14870]
Mouse Orthologues:
AL591864.1, AL592187.1, AL592187.2, Apol10a, Apol10b, Apol6, Apol7a, Apol7b, Apol7c, Apol7e, Apol8, Apol9a, Apol9b
Mouse Descriptions:
apolipoprotein L 10a Gene [Source:MGI Symbol;Acc:MGI:3036238]
apolipoprotein L 10b Gene [Source:MGI Symbol;Acc:MGI:3043522]
apolipoprotein L 11a [Source:RefSeq peptide;Acc:NP_001171004]
apolipoprotein L 11b [Source:RefSeq peptide;Acc:NP_001137158]
apolipoprotein L 6 Gene [Source:MGI Symbol;Acc:MGI:1919189]
apolipoprotein L 7a Gene [Source:MGI Symbol;Acc:MGI:1923011]
apolipoprotein L 7b Gene [Source:MGI Symbol;Acc:MGI:3583950]
apolipoprotein L 7c Gene [Source:MGI Symbol;Acc:MGI:1920912]
apolipoprotein L 7e Gene [Source:MGI Symbol;Acc:MGI:3704456]
apolipoprotein L 8 Gene [Source:MGI Symbol;Acc:MGI:2444921]
apolipoprotein L 9a Gene [Source:MGI Symbol;Acc:MGI:3606001]
apolipoprotein L 9b Gene [Source:MGI Symbol;Acc:MGI:1919148]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40821 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098148 Essential Splice Site 28 470 3 12
Genomic Location (Zv9):
Chromosome 7 (position 2721499)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 2297646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGTTTTTAAAGATATGAGTGTAAAAGTGTGTTTGTGGTGGTGTTGC[A/G]GGAATCATCTGTGTGCAGTTCCTCCTCCAGGCCTGAGGCGGCAGGAGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Glomerulosclerosis: A risk allele for focal segmental glomerulosclerosis in African Americans is located within a region containing APOL1 and MYH9. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link