trps1

Ensembl ID:
ENSDARG00000068028
ZFIN ID:
ZDB-GENE-030131-8404
Description:
trichorhinophalangeal syndrome I [Source:RefSeq peptide;Acc:NP_001171405]
Human Orthologue:
TRPS1
Human Description:
trichorhinophalangeal syndrome I [Source:HGNC Symbol;Acc:12340]
Mouse Orthologue:
Trps1
Mouse Description:
trichorhinophalangeal syndrome I (human) Gene [Source:MGI Symbol;Acc:MGI:1927616]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9617 Nonsense Available for shipment Available now
sa9881 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056809 Nonsense 957 1243 7 7
ENSDART00000098145 Nonsense 957 1243 8 8
ENSDART00000141851 Nonsense 329 615 3 3
ENSDART00000056809 Nonsense 957 1243 7 7
ENSDART00000098145 Nonsense 957 1243 8 8
ENSDART00000141851 Nonsense 329 615 3 3
Genomic Location:
Chromosome 19 (position 47138963)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTATCACGAGCAGAGGCCCAAGTCAAATACGAGGCTTACGGCCCCTCT[G/T]GAACCAAAAGTCACCCCAGTCCCCGTTCCACACAYGCTTTCCTCGTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056809 Nonsense 957 1243 7 7
ENSDART00000098145 Nonsense 957 1243 8 8
ENSDART00000141851 Nonsense 329 615 3 3
ENSDART00000056809 Nonsense 957 1243 7 7
ENSDART00000098145 Nonsense 957 1243 8 8
ENSDART00000141851 Nonsense 329 615 3 3
Genomic Location:
Chromosome 19 (position 47138963)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTATCACGAGCAGAGGCCCAAGTCAAATACGAGGCTTACGGCCCCTCT[G/T]GAACCAAAAGTCACCCCAGTCCCCGTTCCACACAYGCTTTCCTCGTCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/33fl2vwh