ENSDARG00000068026

Ensembl ID:
ENSDARG00000068026
Human Orthologue:
PRKG1
Human Description:
protein kinase, cGMP-dependent, type I [Source:HGNC Symbol;Acc:9414]
Mouse Orthologue:
Prkg1
Mouse Description:
protein kinase, cGMP-dependent, type I Gene [Source:MGI Symbol;Acc:MGI:108174]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41301 Nonsense Mutation detected in F1 DNA During 2016
sa31686 Nonsense Mutation detected in F1 DNA During 2016
sa25410 Nonsense Mutation detected in F1 DNA During 2016
sa1566 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa41301
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098135 Nonsense 8 481 1 13
Genomic Location:
Chromosome 8 (position 53208142)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTCTGTGTCCTGTTATCCAGGGGCTCATGGGGACCCTCAGAGATCTT[C/T]AATTCGCACTTCAGCTGAAGATTGAGGAGTTACGGCAGAGAGATGCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31686
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098135 Nonsense 64 481 2 13
Genomic Location:
Chromosome 8 (position 53199713)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAACATCTCATTATTCCTCCTAACTGTCAATTCATTTGCATTTAGGT[C/T]AACAGCGCGCTTCTTCCCTGAGAGCGAGGCGGAAAACTCTGGTAACAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098135 Nonsense 119 481 3 13
Genomic Location:
Chromosome 8 (position 53199460)
KASP Assay ID:
554-7427.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAGAGACTGATAGAATCAGCTTTAGCAGAAAATGAGTGCATGAAATA[T/A]CTGGACCGGGACCAGCTGCAGTGTTTGGTAGATTCTGCCTATCCCACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1566
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098135 Nonsense 139 481 3 13
Genomic Location:
Chromosome 8 (position 53199402)
KASP Assay ID:
554-1509.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGACCAGCTGCAGKGTTTGGTAGATTCTGCCTATCCCACCAWGCTCAAA[C/T]AGGGTGTGTGTCTCTTCCAGGAAGGGGAACATGGAGCCCAGGCTTACATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link