ENSDARG00000068026

Ensembl ID:
ENSDARG00000068026
Human Orthologue:
PRKG1
Human Description:
protein kinase, cGMP-dependent, type I [Source:HGNC Symbol;Acc:9414]
Mouse Orthologue:
Prkg1
Mouse Description:
protein kinase, cGMP-dependent, type I Gene [Source:MGI Symbol;Acc:MGI:108174]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25410 Nonsense Mutation detected in F1 DNA During 2014
sa1566 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa25410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098135 Nonsense 119 481 3 13
Genomic Location:
Chromosome 8 (position 53199460)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAGAGACTGATAGAATCAGCTTTAGCAGAAAATGAGTGCATGAAATA[T/A]CTGGACCGGGACCAGCTGCAGTGTTTGGTAGATTCTGCCTATCCCACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1566
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098135 Nonsense 139 481 3 13
Genomic Location:
Chromosome 8 (position 53199402)
KASP Assay ID:
554-1509.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGACCAGCTGCAGKGTTTGGTAGATTCTGCCTATCCCACCAWGCTCAAA[C/T]AGGGTGTGTGTCTCTTCCAGGAAGGGGAACATGGAGCCCAGGCTTACATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hpzmfdbu