si:ch211-224b1.4

Ensembl ID:
ENSDARG00000068021
ZFIN ID:
ZDB-GENE-070912-214
Description:
Novel protein with Methyltransferase domains [Source:UniProtKB/TrEMBL;Acc:B0V121]
Human Orthologue:
METTL13
Human Description:
methyltransferase like 13 [Source:HGNC Symbol;Acc:24248]
Mouse Orthologue:
Mettl13
Mouse Description:
methyltransferase like 13 Gene [Source:MGI Symbol;Acc:MGI:1918699]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19861 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19861
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098123 Nonsense 66 243 3 4
ENSDART00000147292 Nonsense 66 167 3 5
Genomic Location (Zv9):
Chromosome 2 (position 44898838)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44984339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTCTCTGTCAGGTTGTGGTAACAGTGCGCTGAGCTATGATATGTGC[C/T]AGGCCGGCTACAGCTCCATCACTAATGTGGATTACTCTAGTGTCTGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link