LOC100332016

Ensembl ID:
ENSDARG00000068019
Human Orthologue:
SOX8
Human Description:
SRY (sex determining region Y)-box 8 [Source:HGNC Symbol;Acc:11203]
Mouse Orthologue:
Sox8
Mouse Description:
SRY-box containing gene 8 Gene [Source:MGI Symbol;Acc:MGI:98370]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10674 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098117 Nonsense 88 414 2 4
Genomic Location (Zv9):
Chromosome 12 (position 1289378)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 1152686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCGCAGGWCCTGAAGGGCTACGACTGGTCCCTRGTGCCGATGCCGATG[C/T]AGGGAAGTCGGTCWCTGAAGGACAAACCGCACGTGAAGAGACCCATGAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link