ARHGAP44 (2 of 2)

Ensembl ID:
ENSDARG00000068008
Description:
Rho GTPase activating protein 44 [Source:HGNC Symbol;Acc:29096]
Human Orthologue:
ARHGAP44
Human Description:
Rho GTPase activating protein 44 [Source:HGNC Symbol;Acc:29096]
Mouse Orthologue:
AU040829
Mouse Description:
expressed sequence AU040829 Gene [Source:MGI Symbol;Acc:MGI:2144423]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7709 Nonsense Mutation detected in F1 DNA During 2014
sa4481 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098100 Nonsense 387 735 14 22
Genomic Location:
Chromosome 12 (position 49818384)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGGTATTTAATCAARTTTCTTGCCAAGATGAACGAGTATCAGGAGTA[T/A]AATAAAATGACTCCAGGAAACATTGCAAWCGTTCTGGGGCCCAACCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4481
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098100 Essential Splice Site 501 735 16 22
Genomic Location:
Chromosome 12 (position 49822221)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGCGTCGCCACCGATAACATGATGCTGGAGTTCTACAAGAAAGACGG[G/A]TACACACCGACGCATWATAACAACWTTATCCAGCAGAGTTATYCATTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wwxxlv1c