ARHGAP44 (2 of 2)

Ensembl ID:
ENSDARG00000068008
Description:
Rho GTPase activating protein 44 [Source:HGNC Symbol;Acc:29096]
Human Orthologue:
ARHGAP44
Human Description:
Rho GTPase activating protein 44 [Source:HGNC Symbol;Acc:29096]
Mouse Orthologue:
AU040829
Mouse Description:
expressed sequence AU040829 Gene [Source:MGI Symbol;Acc:MGI:2144423]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38912 Essential Splice Site Mutation detected in F1 DNA During 2016
sa7709 Nonsense Mutation detected in F1 DNA During 2016
sa4481 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098100 Essential Splice Site 14 735 1 22
Genomic Location:
Chromosome 12 (position 49803030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCATTCAGCAAAAGAAATGTAGAAAATATGTGCGTGTACAAATTAGC[T/A]AAAATCTTCAGTAATGCCTAAATATTTCATAATATCATACATGAAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098100 Nonsense 387 735 14 22
Genomic Location:
Chromosome 12 (position 49818384)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGGTATTTAATCAARTTTCTTGCCAAGATGAACGAGTATCAGGAGTA[T/A]AATAAAATGACTCCAGGAAACATTGCAAWCGTTCTGGGGCCCAACCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4481
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098100 Essential Splice Site 501 735 16 22
Genomic Location:
Chromosome 12 (position 49822221)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGCGTCGCCACCGATAACATGATGCTGGAGTTCTACAAGAAAGACGG[G/A]TACACACCGACGCATWATAACAACWTTATCCAGCAGAGTTATYCATTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link