myhz1.3

Ensembl ID:
ENSDARG00000067997
ZFIN ID:
ZDB-GENE-070705-74
Description:
Novel myosin family protein [Source:UniProtKB/TrEMBL;Acc:B8A569]
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20463 Nonsense Mutation detected in F1 DNA During 2016
sa10927 Essential Splice Site Available for shipment Available now
sa40477 Nonsense Mutation detected in F1 DNA During 2016
sa6057 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20463
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122889 Nonsense 409 1937 13 41
ENSDART00000127125   None 423 None 9
ENSDART00000130531 Nonsense 409 790 13 21
Genomic Location (Zv9):
Chromosome 5 (position 33909193)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31671425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTTTGAACTCTGCTGATATGCTTAAGGCTTTGTGTTACCCCAGAGTC[A/T]AGGTCGGAAATGAGTTTGTGACCAAAGGACAGACTGTGCCACAGGTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10927
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122889 Essential Splice Site 723 1937 19 41
ENSDART00000127125   None 423 None 9
ENSDART00000130531 Essential Splice Site 723 790 19 21
Genomic Location (Zv9):
Chromosome 5 (position 33907635)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31669867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGAAAGGGTTTCCCCAGCAGAATCCTCTATGGTGACTTCAAGCAGAG[G/T]TAAATGGGACTTTATGAAAATGTAATTTACTGTAAGAGTCAATTTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122889 Nonsense 1744 1937 36 41
ENSDART00000127125 Nonsense 230 423 4 9
ENSDART00000130531   None 790 None 21
Genomic Location (Zv9):
Chromosome 5 (position 33901240)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31663472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCAAGAAGAAGCTTGAGGCTGACCTTGTTCAGATCCAGAGTGAAGTT[G/T]AAGACACTGTACAGGAAGCCAGAAATGCAGAGGAGAAGGCCAAGAAGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122889 Nonsense 1876 1937 39 41
ENSDART00000127125 Nonsense 362 423 7 9
ENSDART00000130531   None 790 None 21
Genomic Location (Zv9):
Chromosome 5 (position 33900549)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31662781
KASP Assay ID:
554-3885.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGAAGAATGTCAACAGGCTGCAGGATCTGGTTGATAAGCTTCAGCTG[A/T]AGGTCAAGGCTTMCAAGAGACAGTCTGAAGAAGCTGTGAGTTCCTCATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link