myhz1.2

Ensembl ID:
ENSDARG00000067995
ZFIN ID:
ZDB-GENE-070705-73
Description:
myosin, heavy polypeptide 1.2, skeletal muscle [Source:RefSeq peptide;Acc:NP_001154918]
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16809 Essential Splice Site Available for shipment Available now
sa11919 Essential Splice Site Available for shipment Available now
sa15463 Nonsense Available for shipment Available now
sa5743 Essential Splice Site Mutation detected in F1 DNA Unknown
sa25302 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10023 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098066 None None 446 None 11
ENSDART00000098067 Essential Splice Site 117 1937 2 39
ENSDART00000110726 Essential Splice Site 117 945 4 24
ENSDART00000131983 Essential Splice Site 117 1937 4 41
Genomic Location:
Chromosome 5 (position 33928923)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTGTGCTGTATAACCTCAAAGAGCGTTATGCAGCATGGATGATCTAC[G/T]TAAGCTCTAAAACAACCTAAAGCAGCACTTCCACACATTTACATCTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098066 None None 446 None 11
ENSDART00000098067 Essential Splice Site 654 1937 15 39
ENSDART00000110726 Essential Splice Site 654 945 17 24
ENSDART00000131983 Essential Splice Site 654 1937 17 41
Genomic Location:
Chromosome 5 (position 33925972)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAAAGAAGAAGGGTGGTTCCATGCAGACTGTGTCTTCCCAGTTCAGG[G/A]TRTTTRTTTTGTTTTTGTTTTGAGACCAAATGTAAACAGTTATCAAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098066 None None 446 None 11
ENSDART00000098067 Nonsense 1257 1937 26 39
ENSDART00000110726 None None 945 None 24
ENSDART00000131983 Nonsense 1257 1937 28 41
Genomic Location:
Chromosome 5 (position 33922889)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTRTTTTTACAGGCCAATCTAGAGAAGATGTGCCGCACACTTGAGGAC[C/T]AACTTAGTGAAATTAAGTCTAAGAATGATGAGAACCTTCGCCAGTTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098066 None None 446 None 11
ENSDART00000098067 Essential Splice Site 1326 1937 27 39
ENSDART00000110726 None None 945 None 24
ENSDART00000131983 Essential Splice Site 1326 1937 29 41
Genomic Location:
Chromosome 5 (position 33922446)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACTCAGCAAATTGAGGAGCTTAAGAGGCAGATTGAAGAGGAGGTTAAG[G/A]TAATACAATATAAAATATACATTTATATATCCCACATTTACTATAGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098066 None None 446 None 11
ENSDART00000098067 Essential Splice Site 1453 1937 29 39
ENSDART00000110726 None None 945 None 24
ENSDART00000131983 Essential Splice Site 1453 1937 31 41
Genomic Location:
Chromosome 5 (position 33921904)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACGCTTTGGCTGCCAACCTTGACAAAAAGCAGAGGAACTTTGACAAG[G/T]TAAAATTTGGAGTCATGTTGTGATGTGATGTTCTATTTCAGAAAGTAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10023
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098066 Nonsense 176 446 4 11
ENSDART00000098067 Nonsense 1666 1937 33 39
ENSDART00000110726 None None 945 None 24
ENSDART00000131983 Nonsense 1666 1937 35 41
Genomic Location:
Chromosome 5 (position 33920902)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTTRTGTTCAGGATGCCCAGCTGCACCTTGATGATGCCGTGAGAGGA[C/T]AGGAAGACATGAAGGAGCAGGTGGCCATGGTGGAGCGCAGAAATACTCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ki5suhnd