LOC100334656

Ensembl ID:
ENSDARG00000067992
Human Orthologue:
CD200
Human Description:
CD200 molecule [Source:HGNC Symbol;Acc:7203]
Mouse Orthologue:
Cd200
Mouse Description:
CD200 antigen Gene [Source:MGI Symbol;Acc:MGI:1196990]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4832 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18687 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080503 Essential Splice Site 126 259 2 4
ENSDART00000080503 Essential Splice Site 126 259 2 4
Genomic Location:
Chromosome 1 (position 9845174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTATCCAACAGGACCCAAACGAGAAACCTTGTGCGTCACTGTTAAAGG[T/C]AGGTTAACAAMACTTTGACMCAACTGTGCTTATTACTGTTTACTAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080503 Essential Splice Site 126 259 2 4
ENSDART00000080503 Essential Splice Site 126 259 2 4
Genomic Location:
Chromosome 1 (position 9845174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTATCCAACAGGACCCAAACGAGAAACCTTGTGCGTCACTGTTAAAGG[T/C]AGGTTAACAACACTTTGACACAACTGTGCTTATTACTGTTTACTAAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dozovnr3