myhz1.1

Ensembl ID:
ENSDARG00000067990
ZFIN ID:
ZDB-GENE-000322-5
Description:
myosin, heavy polypeptide 1.1, skeletal muscle [Source:RefSeq peptide;Acc:NP_001108561]
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40478 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33640 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098060 Essential Splice Site 1550 1937 31 39
ENSDART00000098072 Essential Splice Site 65 451 31 40
ENSDART00000109263 Essential Splice Site 1551 1938 31 40
ENSDART00000123003 Essential Splice Site 1550 1937 33 41
ENSDART00000129660   None 931 None 23
Genomic Location (Zv9):
Chromosome 5 (position 33938308)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31700540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGGAGACTGAGAAGGCAGAGATTCAGACTGCCCTGGAGGAGGCTGAA[G/A]TGAGTATCCGGAGATGGAGATTTATATGGGGTTATCTCTAAAACATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098060 Nonsense 1900 1937 38 39
ENSDART00000098072 Nonsense 414 451 39 40
ENSDART00000109263 Nonsense 1901 1938 39 40
ENSDART00000123003 Nonsense 1900 1937 40 41
ENSDART00000129660   None 931 None 23
Genomic Location (Zv9):
Chromosome 5 (position 33936539)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31698771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGACTTTGCAGGAGGAACAAGCCAACTCTCACCTGTCCAAGTTGAGG[A/T]AGGTGCAGCATGAGCTGGAGGAGGCTGAGGAGCGCGCTGACATTGCCGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link