ENSDARG00000067989

Ensembl ID:
ENSDARG00000067989
Human Orthologue:
EPS15L1
Human Description:
epidermal growth factor receptor pathway substrate 15-like 1 [Source:HGNC Symbol;Acc:24634]
Mouse Orthologue:
Eps15l1
Mouse Description:
epidermal growth factor receptor pathway substrate 15-like 1 Gene [Source:MGI Symbol;Acc:MGI:104582]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33060 Essential Splice Site Mutation detected in F1 DNA During 2017
sa25940 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083864 Essential Splice Site 105 675 5 21
ENSDART00000083864 Essential Splice Site 105 675 5 21
Genomic Location (Zv9):
Chromosome 2 (position 55864013)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55649594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCTGAACAGTTTAAGCCAGAACATCTCCGCACCCATGCCTAAATTTG[T/A]GAGTATTGGGTCTAGGGTTGCAAATTTCCATGTGAACTAATGGGAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083864 Essential Splice Site 127 675 6 21
Genomic Location (Zv9):
Chromosome 2 (position 55867103)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55646504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCGCTGAATATAACTGGCTCTTCTGCTGATTCCAGCTGGACAGTGAAG[G/A]TATAAACAATCATTCATTCATTCGGTTTCCTTTGGCTTAGTTTCTTATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link