gas1b

Ensembl ID:
ENSDARG00000067984
ZFIN ID:
ZDB-GENE-050302-79
Description:
growth arrest-specific 1b [Source:RefSeq peptide;Acc:NP_001071269]
Human Orthologue:
GAS1
Human Description:
growth arrest-specific 1 [Source:HGNC Symbol;Acc:4165]
Mouse Orthologue:
Gas1
Mouse Description:
growth arrest specific 1 Gene [Source:MGI Symbol;Acc:MGI:95655]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31461 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31461
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098045 Nonsense 151 263 1 1
Genomic Location (Zv9):
Chromosome 5 (position 34000144)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31762376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAAGCAGTGCGAGAAGGACCCCGAGTGCAAGACCGCCATGCTGGACTA[T/A]CTGTACCACTGCAGGAAACTTTTCGGAGGAAACCGCTGCTCGGACGACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Insulin resistance/response: Genome-wide detection of allele specific copy number variation associated with insulin resistance in African Americans from the HyperGEN study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link