gpr107

Ensembl ID:
ENSDARG00000067982
ZFIN ID:
ZDB-GENE-061103-130
Description:
protein GPR107 [Source:RefSeq peptide;Acc:NP_001073515]
Human Orthologue:
GPR107
Human Description:
G protein-coupled receptor 107 [Source:HGNC Symbol;Acc:17830]
Mouse Orthologue:
Gpr107
Mouse Description:
G protein-coupled receptor 107 Gene [Source:MGI Symbol;Acc:MGI:2139054]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33644 Nonsense Mutation detected in F1 DNA During 2017
sa2241 Nonsense F2 line generated During 2017
sa40480 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33643 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40479 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098036 Nonsense 7 543 1 18
Genomic Location (Zv9):
Chromosome 5 (position 34107656)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31889605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTCTTGTTTGTTGAAGCGGTTTTAAAAATGGCGTCCGGAAAGATGTG[T/A]ATGTTTACAGTTATTAATGTGATTATTATAGTGCTTGTCATAGAAAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2241
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098036 Nonsense 183 543 7 18
Genomic Location (Zv9):
Chromosome 5 (position 34103011)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31884960
KASP Assay ID:
554-3162.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACAGATATAGATTTTTCCCTTTCCCTAGAACAAGGCAGAAGATACCTA[T/A]CCTCTTCAGTACGAAGATAACGGCTACTCCTTCCAGGTAGGASRTGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40480
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098036 Essential Splice Site 281 543 9 18
Genomic Location (Zv9):
Chromosome 5 (position 34102473)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31884422
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCTTCCTCATTGGCATACTGTGGGTTCATGTTTTGCGGACACATAGG[T/C]AAGTCTTGTGCGTTATATCTGACTTCACGCACACATGCTATAAATGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098036 Essential Splice Site 445 543 15 18
Genomic Location (Zv9):
Chromosome 5 (position 34090490)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31872439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCATCAATCTGGCTCAACTGAAACTATTTAGGCACTACTATGTGATGG[T/A]AAGTATTCACCAGAACACGCCCCTGATGCTCAGATCTAAACAGGCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098036 Nonsense 470 543 16 18
Genomic Location (Zv9):
Chromosome 5 (position 34089579)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31871528
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCATCATTGCCAGTCTCATCAAGGTCATTGTTCCTTTCCAGTGGAAGTG[G/A]CTTTACCAGGTGAGTGACATACAGAAAAGACCTGTTTTATAAGCATGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link