ar

Ensembl ID:
ENSDARG00000067976
ZFIN ID:
ZDB-GENE-060131-1
Description:
androgen receptor [Source:RefSeq peptide;Acc:NP_001076592]
Human Orthologue:
AR
Human Description:
androgen receptor [Source:HGNC Symbol;Acc:644]
Mouse Orthologue:
Ar
Mouse Description:
androgen receptor Gene [Source:MGI Symbol;Acc:MGI:88064]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20471 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014
sa20472 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098022 Missense 177 868 1 8
ENSDART00000125329 Essential Splice Site 170 860 None 9
Genomic Location:
Chromosome 5 (position 37180130)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTGCGTGCACCACCGCCACCATCACCTCCAGCAGCAGCAGCAGCAGCA[C/G]CACTACCAGCTGCACCATATCAGAGACAGCGCGAGAGTTGTGCAAAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20472
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098022 Nonsense 509 868 2 8
ENSDART00000125329 Nonsense 501 860 3 9
Genomic Location:
Chromosome 5 (position 37225825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGACGGAGGGAGGAGTGACATTTTCCCAATGGAGTTTTTCCTTCCTCCA[C/T]AAAGGACCTGCCTAATCTGCTCTGATGAAGCATCTGGGTGTCACTACGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wmxo9gnh