sh3gl1a

Ensembl ID:
ENSDARG00000067958
ZFIN ID:
ZDB-GENE-030131-4524
Description:
SH3-domain GRB2-like 1a isoform 1 [Source:RefSeq peptide;Acc:NP_001099076]
Human Orthologue:
SH3GL1
Human Description:
SH3-domain GRB2-like 1 [Source:HGNC Symbol;Acc:10830]
Mouse Orthologue:
Sh3gl1
Mouse Description:
SH3-domain GRB2-like 1 Gene [Source:MGI Symbol;Acc:MGI:700010]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19889 Nonsense Available for shipment Available now
sa19890 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19889
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097966 Nonsense 21 365 3 11
ENSDART00000129967 Nonsense 22 365 2 10
Genomic Location (Zv9):
Chromosome 2 (position 50049409)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49744941
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTGACTTTTATTTGTTTTTTTTATTCTAGTTGATGAGTGAGAAGGTT[G/T]GAGGAGCAGAAGGAACCAAACTGGACGAGGACTTCAAAGATCTGGAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19890
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097966 Essential Splice Site 110 365 5 11
ENSDART00000129967 Essential Splice Site 111 365 4 10
Genomic Location (Zv9):
Chromosome 2 (position 50056364)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 49751896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGCATGCTGAAATACGGTCGAGACATGGGAGAAGACACCAACTTCGG[T/A]AAGAAGAACGAGTGCTCTTTCTCTAACACTTTAACAAACAGAAAACTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link