actr8

Ensembl ID:
ENSDARG00000067944
ZFIN ID:
ZDB-GENE-030131-5065
Description:
Actin-related protein 8 [Source:UniProtKB/Swiss-Prot;Acc:P59679]
Human Orthologue:
ACTR8
Human Description:
ARP8 actin-related protein 8 homolog (yeast) [Source:HGNC Symbol;Acc:14672]
Mouse Orthologue:
Actr8
Mouse Description:
ARP8 actin-related protein 8 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1860775]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25411 Splice Site, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097923 Splice Site, Nonsense 435 623 11 13
Genomic Location:
Chromosome 8 (position 55510270)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGATCAAACTGTAGTAGCATTAATCTGCCTCTCTCTCTCTCTTTAGT[C/A]GTCTAAAGCCAGCGCAGATCGTAAATCCTTCCCCAAACCGAGCAGTTTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cgvclhat