LOC557645

Ensembl ID:
ENSDARG00000067925
Human Orthologue:
SSTR4
Human Description:
somatostatin receptor 4 [Source:HGNC Symbol;Acc:11333]
Mouse Orthologue:
Sstr4
Mouse Description:
somatostatin receptor 4 Gene [Source:MGI Symbol;Acc:MGI:105372]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5761 Nonsense F2 line generated During 2014
sa2398 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5761
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097882 Nonsense 188 371 1 1
ENSDART00000097882 Nonsense 188 371 1 1
Genomic Location:
Chromosome 7 (position 19630327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATTATCTTCGCAGACACYGTCCCTGCGCAGGATGGAGGGGTGGACTG[C/A]AATTTCATGTGGCCTGAGTCTTCGTGGTCCGAAGCGTTYGTGGTTTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097882 Nonsense 188 371 1 1
ENSDART00000097882 Nonsense 188 371 1 1
Genomic Location:
Chromosome 7 (position 19630327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATTATCTTCGCAGACACYGTCCCTGCGCAGGATGGAGGGGTGGACTG[C/A]AATTTCATGTGGCCTGAGTCTTCGTGGTCCGAAGCGTTYGTGGTTTATAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a7a2stw2