rab8a

Ensembl ID:
ENSDARG00000067920
ZFIN ID:
ZDB-GENE-070424-36
Description:
ras-related protein Rab-8A [Source:RefSeq peptide;Acc:NP_001083031]
Human Orthologue:
RAB8A
Human Description:
RAB8A, member RAS oncogene family [Source:HGNC Symbol;Acc:7007]
Mouse Orthologue:
Rab8a
Mouse Description:
RAB8A, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:96960]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa394 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086326 Nonsense 60 210 2 8
Genomic Location:
Chromosome 2 (position 55985982)
KASP Assay ID:
554-0256.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGATTTCAAGATCAGGACAATAGAACTAGATGGCAAGAAGATAAAGTTA[C/T]AGATATGGTGAGTTTCTAGACTTCTTTCCTCCAACAAGTAGTTGAACATT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4cb25ia1