ints9

Ensembl ID:
ENSDARG00000067913
ZFIN ID:
ZDB-GENE-061013-129
Description:
integrator complex subunit 9 [Source:RefSeq peptide;Acc:NP_001070738]
Human Orthologue:
INTS9
Human Description:
integrator complex subunit 9 [Source:HGNC Symbol;Acc:25592]
Mouse Orthologue:
Ints9
Mouse Description:
integrator complex subunit 9 Gene [Source:MGI Symbol;Acc:MGI:1098533]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37168 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12617 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37168
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097865 Essential Splice Site 46 658 2 17
Genomic Location:
Chromosome 20 (position 50207865)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGACACAACAGCGGCTCTCTATTTCCTGCCCCTGCCTTTAGTTCACAG[G/A]TCAGTAAAACAGCTACAGCACGCACACACACACACACACATCTACACGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097865 Nonsense 218 658 8 17
Genomic Location:
Chromosome 20 (position 50214310)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAGGAGCTGTTCGGAGCRGTGCAGGTCACACCGCTCAGTTCAGGATA[T/G]TCTCTGGGCAGCTCAAACTGGATCATCCAATCACAYTATGAGAAAGTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link