MAN1C1

Ensembl ID:
ENSDARG00000067912
Description:
mannosidase, alpha, class 1C, member 1 [Source:HGNC Symbol;Acc:19080]
Human Orthologue:
MAN1C1
Human Description:
mannosidase, alpha, class 1C, member 1 [Source:HGNC Symbol;Acc:19080]
Mouse Orthologue:
Man1c1
Mouse Description:
mannosidase, alpha, class 1C, member 1 Gene [Source:MGI Symbol;Acc:MGI:2446214]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22956 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22956
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097863 Essential Splice Site 49 404 2 10
Genomic Location:
Chromosome 16 (position 55728634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGTTATGTCGGTGGTCTTCTGTCTGCGTTTTACCTGACTGGAGCTGAG[G/A]TAAGGTTCATTTTCATTATTCGCTGAAGTCTGAGAGACCAGGAATGATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/crumm120