scospondin

Ensembl ID:
ENSDARG00000067859
ZFIN ID:
ZDB-GENE-051114-1
Description:
Subcommissural organ spondin [Source:UniProtKB/TrEMBL;Acc:A3KPT1]
Mouse Orthologue:
Sspo
Mouse Description:
SCO-spondin Gene [Source:MGI Symbol;Acc:MGI:2674311]

Alleles

There are 15 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17228 Nonsense Available for shipment Available now
sa16303 Essential Splice Site Available for shipment Available now
sa13835 Splice Site, Nonsense Available for shipment Available now
sa44197 Nonsense Mutation detected in F1 DNA During 2017
sa30152 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37962 Nonsense Mutation detected in F1 DNA During 2017
sa24566 Nonsense Available for shipment Available now
sa37963 Nonsense Mutation detected in F1 DNA During 2017
sa24567 Nonsense Available for shipment Available now
sa1281 Essential Splice Site Available for shipment Available now
sa3255 Essential Splice Site F2 line generated During 2017
sa24568 Essential Splice Site Available for shipment Available now
sa8859 Nonsense Mutation detected in F1 DNA During 2017
sa37964 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37965 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 360 4661 8 94
ENSDART00000136590 Nonsense 360 899 9 19
Genomic Location (Zv9):
Chromosome 24 (position 41605781)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40144975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTCTCAGTACGCTGCCAGCTTTGGAAACTCATGGCGCGTACAAGAT[C/T]AACAACAAAGCCAGGTGAWATGCTGCTTTTAGATACACATGGCKAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Essential Splice Site 459 4661 10 94
ENSDART00000136590 Essential Splice Site 459 899 11 19
Genomic Location (Zv9):
Chromosome 24 (position 41607324)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40146518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCTCAACAACACAKCATTATCAGCTGGAGGAGAAGAGGATTTTGTGG[T/A]RCTGTTGACTTTTTCTTAAACTAACAGTARCATGCTTTTGACTTRTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13835
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Splice Site, Nonsense 758 4661 15 94
ENSDART00000136590 Splice Site, Nonsense 758 899 16 19
Genomic Location (Zv9):
Chromosome 24 (position 41613271)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40152465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGACAGCTGGCAGAGAGAGTGTGTTCAGTCATYCACAGCAATGTCTTT[C/T]AGGTCAGTCTGATGAYGGCACGGCTATTATAGCAAWTTTACATTTTAACNT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 1520 4661 28 94
ENSDART00000136590   None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41638945)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40178139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGCTGTTTCTGCACCGCTGTGATGGTCACGATGACTGCGGAGATTA[C/A]AGTGATGAGCGAGGGTGTGTGTGTGCTCTCGGAGAGCTCCAGTGTCCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30152
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Essential Splice Site 2426 4661 43 94
ENSDART00000136590   None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41668518)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40207444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGACGGGCATGAAGACTGTCCTGACGGATCAGATGAACTTCACTGTGG[T/A]AAAAAAAATAAAATAGCTCATCTATTTTGATTATTATATCCATTCAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 2694 4661 49 94
ENSDART00000136590   None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41671824)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40210750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTTTATCCAATCATAAACAGTGTGTGTAAAGATGGGCGTGTCCTATG[T/A]GATGAGTCCAGCTGTGTCGCTCGATGTGATTGGTCGGCCTGGTCTTCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24566
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 2710 4661 49 94
ENSDART00000136590   None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41671871)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40210797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGATGAGTCCAGCTGTGTCGCTCGATGTGATTGGTCGGCCTGGTCTT[C/A]GTGGACATCATGTGACAGCAGCTGCGGGACAGGAGTACAGCACCGCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 3409 4661 65 94
ENSDART00000136590   None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41692080)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40231006
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCGTGGTCAGAGTGTGACGCATGCGCGGGTGTCTCAGTCAGACAGAGG[C/T]AGTGTCACAGTCCTCCAGCGCGCTTTGGAGGTCTGCCCTGCATGGGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24567
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 3677 4661 71 94
ENSDART00000136590   None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41700539)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40239465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGCAGGAATGTCCGTGTGTGGTGGACTCTGACCTCTTGACCTCTCTA[C/T]AAAGTGTGTTGGAGACCCCTGATGTGACCTTTGACATCCACAACATCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1281
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Essential Splice Site 3797 4661 73 94
ENSDART00000136590   None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41701109)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40240035
KASP Assay ID:
554-1196.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTANNNNATTTACAGGTGTAACAGTTCCAACGGAGGAGCCATCTTTACCAGG[T/C]AATGATTGGATGTTTATTCATTCATTCATTCATTAATTCATTCATTCATT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa3255
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Essential Splice Site 4217 4661 83 94
ENSDART00000136590   None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41709042)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40247968
KASP Assay ID:
554-2648.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGACCTGAAAGAGACACCCGGGACTGCCATTCTGGACCCTGCCTGGG[T/C]ACTGATACTAAGCAMAAACACATCAACATCCATTCATWCACTCATTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Essential Splice Site 4217 4661 84 94
ENSDART00000136590   None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41710970)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40249896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCTAATAATTCTGAATGTATTGCTGACCTGGTGACCTCTGTGTCCTCC[A/T]GATGACCTCTGCCCCTGGTCGACCTGGTCACGGTGTTCAGTCAGCTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 4306 4661 85 94
ENSDART00000136590   None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41712906)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40251832
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGTTTGAGCTGCGRGTTCGAGTGCCRCTGGTTTTGTCCACCGGGGGG[C/T]AACGCTGYACTGATGTGGAGAAAMAGAGTCGACCCTGCAGACCCCAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Essential Splice Site 4324 4661 85 94
ENSDART00000136590   None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41712964)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40251890
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGATGTGGAGAAACAGAGTCGACCCTGCAGACCCCAAAACTGCAAAG[G/A]TGAACATCAACACACACACACACACACACACACACACACACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097773 Nonsense 4466 4661 91 94
ENSDART00000136590   None 899 None 19
Genomic Location (Zv9):
Chromosome 24 (position 41715325)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40254251
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTATGTGTGTGTGTTTAGATGTGTGTGACTGGAGCTCGTGGAGCAGAT[G/A]GAGTGTGTGTAAAGAGCCCTGCAGTGGAGGATTCAGACACAGAGAGAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link