lcn15

Ensembl ID:
ENSDARG00000067851
ZFIN ID:
ZDB-GENE-060825-349
Description:
prostaglandin-H2 D-isomerase [Source:RefSeq peptide;Acc:NP_001038880]
Human Orthologues:
LCN15, LCNL1
Human Descriptions:
lipocalin 15 [Source:HGNC Symbol;Acc:33777]
lipocalin-like 1 [Source:HGNC Symbol;Acc:34436]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20576 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3512 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097756 Essential Splice Site 186 232 6 7
Genomic Location:
Chromosome 5 (position 68983496)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTCATTCTCTTGTTTTTTTAGATCCCTGCCCTAATCTAGAACCAAGG[T/A]ATGGATTTATCATTTCCTCATACATAAGAGAGGCTGGGGCTGGTTGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097756 Nonsense 220 232 7 7
Genomic Location:
Chromosome 5 (position 68988298)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGGGAACAGTGTTTGTTTTTACACAAACTGTCATTGGAGAAATGCAA[C/T]AGTATTACATCTTCAATGTAACGCAGGCTGTGCTGCATTAATGAAACAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5hgknd43