lcn15

Ensembl ID:
ENSDARG00000067851
ZFIN ID:
ZDB-GENE-060825-349
Description:
prostaglandin-H2 D-isomerase [Source:RefSeq peptide;Acc:NP_001038880]
Human Orthologues:
LCN15, LCNL1
Human Descriptions:
lipocalin 15 [Source:HGNC Symbol;Acc:33777]
lipocalin-like 1 [Source:HGNC Symbol;Acc:34436]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20576 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097756 Essential Splice Site 186 232 6 7
Genomic Location (Zv9):
Chromosome 5 (position 68983496)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65317154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTCATTCTCTTGTTTTTTTAGATCCCTGCCCTAATCTAGAACCAAGG[T/A]ATGGATTTATCATTTCCTCATACATAAGAGAGGCTGGGGCTGGTTGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link