jund

Ensembl ID:
ENSDARG00000067850
ZFIN ID:
ZDB-GENE-070725-2
Description:
transcription factor jun-D [Source:RefSeq peptide;Acc:NP_001121814]
Human Orthologue:
JUND
Human Description:
jun D proto-oncogene [Source:HGNC Symbol;Acc:6206]
Mouse Orthologue:
Jund
Mouse Description:
Jun proto-oncogene related gene d Gene [Source:MGI Symbol;Acc:MGI:96648]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15328 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15328
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097755 Nonsense 140 283 1 1
Genomic Location:
Chromosome 2 (position 56343834)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGCKAACAGCAGCACCAGCCTCGCCTTAAACGCGGATCTGCCCGTGTA[T/A]ACGAACTTGAGCACGTACGGGAGCACCACGGTGAACTATTCCACAGACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ke7sojxe