NP_001122046.1

Ensembl ID:
ENSDARG00000067847
Description:
hypothetical protein LOC100150203 [Source:RefSeq peptide;Acc:NP_001122046]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35618 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097748 Essential Splice Site 98 151 3 6
Genomic Location (Zv9):
Chromosome 14 (position 1319081)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1295655
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGAAGTCACAGAGAAGTGTCCACCACGAGCTGCGCAAATCATTCATC[G/A]TGAGTGTGTGTTTATTACATGAAGAAGCAGTGCATGTACACACCTCAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link