A1L268_DANRE

Ensembl ID:
ENSDARG00000067841
Description:
LOC795175 protein [Source:UniProtKB/TrEMBL;Acc:A1L268]
Mouse Orthologue:
Gm1568
Mouse Description:
predicted gene 1568 Gene [Source:MGI Symbol;Acc:MGI:2686414]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15380 Nonsense Available for shipment Available now
sa23180 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15380
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097737 Nonsense 192 288 2 2
ENSDART00000123266 None None 697 None 4
Genomic Location:
Chromosome 17 (position 48375591)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGGCTTCAGAGAAGTCTGAGGACACTKTAAATGCTGCTTTGTCTCAA[C/T]AAACCAATCATAGTGTAACAAATCCAGCCCCCAAAATGGCTCCACCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097737 Nonsense 215 288 2 2
ENSDART00000123266 Nonsense 171 697 2 4
Genomic Location:
Chromosome 17 (position 48375522)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATCCAGCCCCCAAAATGGCTCCACCTTGTAGCACCGCATCCAAAAAA[C/T]AATCAACATCAACTGCTCCTAAAAGCGTGATAGCAGGATCCGGACAAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/llp4ps9w