ppargc1al

Ensembl ID:
ENSDARG00000067829
ZFIN ID:
ZDB-GENE-080505-1
Description:
Proliferator-activated receptor gamma coactivator 1 alpha [Source:UniProtKB/TrEMBL;Acc:D7F2U9]
Human Orthologue:
PPARGC1A
Human Description:
peroxisome proliferator-activated receptor gamma, coactivator 1 alpha [Source:HGNC Symbol;Acc:9237]
Mouse Orthologue:
Ppargc1a
Mouse Description:
peroxisome proliferative activated receptor, gamma, coactivator 1 alpha Gene [Source:MGI Symbol;Acc:

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34243 Nonsense Mutation detected in F1 DNA During 2017
sa31621 Nonsense Available for shipment Available now
sa13186 Nonsense Available for shipment Available now
sa34242 Nonsense Mutation detected in F1 DNA During 2017
sa7107 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34243
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097710 Nonsense 364 873 8 13
Genomic Location (Zv9):
Chromosome 7 (position 73167826)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 70161594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCCTTTCAAAGTATCACTCAAAAACAAGCTGTCTTCATGCTCTCCCT[C/A]GGCCCTGACAAGCAAAAGGCCCAGGCTGAGTAATGGGGGCTCTTGCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31621
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097710 Nonsense 412 873 8 13
Genomic Location (Zv9):
Chromosome 7 (position 73167682)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 70161450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTATGCCCAGCTGAGCAAGGCGTCCTCCACTATGCCCCAAGGGGGCT[T/A]GGAGGATCGTCGGGGCAAGCGGCCCATGCCCCGTGTCTTTGGCGATCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13186
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097710 Nonsense 502 873 8 13
Genomic Location (Zv9):
Chromosome 7 (position 73167411)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 70161179
KASP Assay ID:
2259-9833.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTTCAAGGCCTTTCCCCAACACCTCAGGAGGCTTGTCCGGACACAWA[T/A]GCTCACGTGCAGCACCACGACTCAAGCTCCAAAATGACAATGGACTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097710 Nonsense 726 873 10 13
Genomic Location (Zv9):
Chromosome 7 (position 73157358)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 70151126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACAGCTATGAGGAATACCAGCACGAGCGTCTGAAGCGAGAGGAGTAC[C/T]GACGCGACTATGAGAAACGGGAATGTGAGAGGGCCGAGCAGAGGGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097710 Nonsense 734 873 10 13
Genomic Location (Zv9):
Chromosome 7 (position 73157332)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 70151100
KASP Assay ID:
554-5312.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCGTCTGAAGCGAGAGGAGTACCGACGCGACTATGARAAACGGGAATG[T/A]GAGAGGGCCGAGCAGAGGGAGAGACAACGGCAAAAAGCAATAGTGAGTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link