LOC100330109

Ensembl ID:
ENSDARG00000067825
Human Orthologue:
GAS1
Human Description:
growth arrest-specific 1 [Source:HGNC Symbol;Acc:4165]
Mouse Orthologue:
Gas1
Mouse Description:
growth arrest specific 1 Gene [Source:MGI Symbol;Acc:MGI:95655]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23211 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23211
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097696 Essential Splice Site 225 233 2 2
ENSDART00000125415 None None 227 None 4
Genomic Location:
Chromosome 18 (position 5059236)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATCTGCATTGGATTCGCTCTAGCTGGATTTTAGAGGGATTTTCGACT[G/A]GAAATCTACATTTTTTGTCATCATTTACTCGTTCAAGTGGATCTAAATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Insulin resistance/response: Genome-wide detection of allele specific copy number variation associated with insulin resistance in African Americans from the HyperGEN study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hnviz4jz