si:ch211-122m3.1

Ensembl ID:
ENSDARG00000067824
ZFIN ID:
ZDB-GENE-091113-51
Human Orthologues:
AL953854.2, CNTNAP3, CNTNAP3B, CNTNAP4, CNTNAP5
Human Descriptions:
contactin associated protein-like 3 [Source:HGNC Symbol;Acc:13834]
contactin associated protein-like 3B [Source:HGNC Symbol;Acc:32035]
contactin associated protein-like 4 [Source:HGNC Symbol;Acc:18747]
contactin associated protein-like 5 [Source:HGNC Symbol;Acc:18748]
Novel protein similar to contactin associated protein-like 3 (CNTNAP3) [Source:UniProtKB/TrEMBL;Acc:
Mouse Orthologues:
Cntnap3, Cntnap4, Cntnap5a, Cntnap5b, Cntnap5c
Mouse Descriptions:
contactin associated protein-like 3 Gene [Source:MGI Symbol;Acc:MGI:3588199]
contactin associated protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:2183572]
contactin associated protein-like 5A Gene [Source:MGI Symbol;Acc:MGI:3643623]
contactin associated protein-like 5B Gene [Source:MGI Symbol;Acc:MGI:3664583]
contactin associated protein-like 5C Gene [Source:MGI Symbol;Acc:MGI:3646013]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7338 Missense Mutation detected in F1 DNA During 2017
sa15180 Essential Splice Site Available for shipment Available now
sa34806 Nonsense Mutation detected in F1 DNA During 2017
sa2546 Essential Splice Site F2 line generated During 2017
sa41568 Nonsense Mutation detected in F1 DNA During 2017
sa16329 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097695 Missense 44 1300 2 24
ENSDART00000136363 Missense 15 1271 1 23

The following transcripts of ENSDARG00000067824 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 2260731)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2206610
KASP Assay ID:
554-4363.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGAGAGCTGTGATTCTCCGCTGGTGTCCGGTTTGCCTCAGTCGGCCT[T/G]CACTAGTTCATCAGAGCTGTCGARCAGTCACGGGCCGGGATTCGCCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15180
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097695 Essential Splice Site 130 1300 3 24
ENSDART00000136363 Essential Splice Site 101 1271 2 23

The following transcripts of ENSDARG00000067824 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 2281587)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2227466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACAYGGGACACAACTGGAGACCGTACCGCCAGGAAGACAGCATAGGG[G/T]TAAGCTTTCAATYCCCTYGGATNGAGAAAAACATGCMTTGGCCTGAKAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097695 Nonsense 417 1300 8 24
ENSDART00000136363 Nonsense 388 1271 7 23

The following transcripts of ENSDARG00000067824 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 2315439)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2261318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTGATGACCTTTGACCTTCAGCAGAACGCAGGAACACTGTGGCTTTA[T/A]CTGAGCGAAGCCAAAGCACGACTGCAGATCCAGAAGAGCGGCCGGATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2546
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097695 Essential Splice Site 488 1300 9 24
ENSDART00000136363 Essential Splice Site 459 1271 8 23

The following transcripts of ENSDARG00000067824 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 2318880)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2264759
KASP Assay ID:
554-2495.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGCCACTTCTGTCTTCGCGGCTCCTGACAGCGTGCTATTCTTAGGCGG[T/G]AAGAAGCACCTTTAGCGTCCGTCGGCTTCTGCTAACACACAGGAGCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41568
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097695 Nonsense 558 1300 11 24
ENSDART00000136363 Nonsense 529 1271 10 23

The following transcripts of ENSDARG00000067824 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 2348358)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2294237
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAGATGCTCCCCGAACCATTGTGAACACGGAGGGAAATGCTCGCAGT[C/A]ATGGAGCACGTTTCACTGCAACTGCTCTGCCACAGGCTACAGCGGAGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16329
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097695 Nonsense 794 1300 16 24
ENSDART00000136363 Nonsense 765 1271 15 23

The following transcripts of ENSDARG00000067824 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 2367376)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2313255
KASP Assay ID:
2260-2730.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTAGGTAACTTCTGGAACACTGCCTACTTCAACAAGGAGACRTCATA[C/A]CTGCACTTTCCCACCTKCCATGGGGAGCTGAGCGCAGACATCTCCTTCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link