ncana

Ensembl ID:
ENSDARG00000067820
ZFIN ID:
ZDB-GENE-051230-1
Description:
Neurocan [Source:UniProtKB/TrEMBL;Acc:Q75T39]
Human Orthologues:
ACAN, BCAN, NCAN, VCAN
Human Descriptions:
aggrecan [Source:HGNC Symbol;Acc:319]
brevican [Source:HGNC Symbol;Acc:23059]
neurocan [Source:HGNC Symbol;Acc:2465]
versican [Source:HGNC Symbol;Acc:2464]
Mouse Orthologues:
Acan, Bcan, Ncan, Vcan
Mouse Descriptions:
aggrecan Gene [Source:MGI Symbol;Acc:MGI:99602]
brevican Gene [Source:MGI Symbol;Acc:MGI:1096385]
neurocan Gene [Source:MGI Symbol;Acc:MGI:104694]
versican Gene [Source:MGI Symbol;Acc:MGI:102889]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33063 Nonsense Mutation detected in F1 DNA During 2017
sa15838 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097691 Nonsense 323 1125 5 16
Genomic Location (Zv9):
Chromosome 2 (position 57630445)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 59459254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTGTGGGCCCCCGGGGGTCTCAGTGTCCCAATGAAGAGCCAGGAGTC[A/T]GAAGAGTTTCTCCTGCAGAGCTCAGCAACGGGACGAAGAGATTCGATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15838
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097691 Essential Splice Site 903 1125 11 16
Genomic Location (Zv9):
Chromosome 2 (position 57676686)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 59413013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGTGTGYCTGTGTTTGCCCAGCTACAGCGGAGACCGAWGTGAGAGAG[G/A]TGAGAAAACAACTCGTCCATTATMACATCACACTCCAAATTAATGAGTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Genome-wide association study identifies genetic variation in neurocan as a susceptibility factor for bipolar disorder. (View Study)
  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)
  • Major depressive disorder: Genome-wide association study of major recurrent depression in the U.K. population. (View Study)
  • Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)
  • Triglycerides: Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts. (View Study)
  • Triglycerides: Newly identified loci that influence lipid concentrations and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link