LOC100004358

Ensembl ID:
ENSDARG00000067814

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19680 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19681 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097683 Essential Splice Site 60 196 2 7
Genomic Location:
Chromosome 2 (position 9338266)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCGCTCGCGCGCTCTCTCCTCTGGAACGTGTCGGCTGTACTAGAGATG[G/A]TGGGTGTTATTTAATAGGACCAGCACATACTACACTTACGCTGTCTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097683 Nonsense 169 196 7 7
Genomic Location:
Chromosome 2 (position 9342258)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTTCCTTCTTCAGGCATCCATGGATCATCAAAAATCTTTTCAAGAA[C/T]GACTGAAGCTGTGTAAAATCCTAAAGGGGTTCAGCCTTCGAGCAATAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/366aryyj