ARFGAP1

Ensembl ID:
ENSDARG00000067809
Description:
ADP-ribosylation factor GTPase activating protein 1 [Source:HGNC Symbol;Acc:15852]
Human Orthologue:
ARFGAP1
Human Description:
ADP-ribosylation factor GTPase activating protein 1 [Source:HGNC Symbol;Acc:15852]
Mouse Orthologue:
Arfgap1
Mouse Description:
ADP-ribosylation factor GTPase activating protein 1 Gene [Source:MGI Symbol;Acc:MGI:2183559]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8679 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097673 Nonsense 336 371 10 10
Genomic Location:
Chromosome 11 (position 48657)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCTCTCAGCGGGAACACCRAGGCTCYGGCCGAACACAAACCCAGCACT[G/T]GAGACGGCTGGGAYGCCTGGGACAACAACTGGGAGACGTCTGGAGGAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qls415cd